Filters
Question type

Study Flashcards

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Mutation rates can vary widely among euk...

View Answer

Which of the following DNA repair systems does NOT involve the activity of a DNA polymerase?


A) mismatch repair in humans
B) nucleotide-excision repair in yeast
C) photoreactivation in E. coli
D) base-excision repair in E. coli
E) All of choices provided involve the activity of a DNA polymerase.

F) B) and C)
G) D) and E)

Correct Answer

verifed

verified

What would be the result of a large deletion in the resolvase gene of a transposable element?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

A large deletion in the resolvase gene o...

View Answer

Give the inverted repeat of the following sequences: a. 5'-ATCCGCT-3' 3'-TAGGCGA-5' b. 5'-AAATTT-3' 3'-TTTAAA-5' c. 5'-GGAATTCC-3' 3'-CCTTAAGG-5'

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Inverted repeats in DNA sequences are se...

View Answer

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago. How would you assess the level of mutations caused by this leak?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

As a geneticist, I would first gather as...

View Answer

How do intergenic and intragenic suppressor mutations differ?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Intergenic and intragenic suppressor mut...

View Answer

A new IS element is found in bacteria. Which of the following pairs of DNA sequences would MOST likely be found at each end of the IS element? (Only one of the two DNA strands is given.)


A) 5´-GAGACTCTAC-3´ and 5´-GAGACTCTAC-3´
B) 5´-GAGACTCTAC-3´ and 5´-CATCTCAGAG-3´
C) 5´-GAGACTCTAC-3´ and 5´-CTCTGAGATG-3´
D) 5´-GAGACTCTAC-3´ and 5´-GTAGAGTCTC-3´
E) 5´-GAGACTCTAC-3´ and 5´-CAGACTCTAG-3´

F) D) and E)
G) A) and B)

Correct Answer

verifed

verified

Which of the following pairs of sequences would you expect to be found in the same transposable element?


A) inverted repeats and a gene for transposase
B) long terminal repeats and a gene for transposase
C) inverted repeats and a gene for reverse transcriptase
D) a gene for transposase and a gene for reverse transcriptase
E) both long terminal repeats and a gene for transposase and inverted repeats and a gene for reverse transcriptase

F) B) and E)
G) B) and C)

Correct Answer

verifed

verified

Practically all transposable elements that have been studied are associated with which of the following?


A) indirect repeats at each end
B) a gene for transposase
C) a gene for reverse transcriptase
D) a gene for RNA polymerase
E) flanking direct repeats

F) A) and D)
G) A) and E)

Correct Answer

verifed

verified

A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.) ATGTTGTTGTTGTTGTTGTGA

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

To solve this problem, we need to unders...

View Answer

A transposable element is found to use RNA as an intermediate in transposition. On the basis of this information, which of the following would you expect to be CORRECT?


A) The transposable element also probably makes transposase.
B) The transposable element may encode a reverse transcriptase.
C) The transposable element is probably located in a bacterial genome.
D) The transposable element probably contains inverted repeats at each end.
E) The transposable element will not be able to transpose without a second copy also present in the genome.

F) C) and D)
G) A) and B)

Correct Answer

verifed

verified

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?


A) a transition mutation at the first position of the codon
B) a transversion mutation at the first position of the codon
C) a transition mutation at the third position of the codon
D) a transversion mutation at the third position of the codon
E) a transition mutation or a transversion mutation at the third position of the codon

F) B) and E)
G) A) and E)

Correct Answer

verifed

verified

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Insertions and deletions (indels) often ...

View Answer

Explain how bacterial resistance to antibiotics can be efficiently transmitted by transposons.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Transposons are genetic elements that ca...

View Answer

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Transposable elements (TEs) are DNA sequ...

View Answer

The mutation shown in the diagram below can BEST be described as a _____ mutation. The mutation shown in the diagram below can BEST be described as a _____ mutation.   A)  missense B)  nonsense C)  silent D)  neutral E)  reverse


A) missense
B) nonsense
C) silent
D) neutral
E) reverse

F) A) and B)
G) B) and D)

Correct Answer

verifed

verified

Which of the following statements about somatic mutations is FALSE?


A) Some may give rise to cancers in humans and other animals.
B) They may be inherited by daughter cells after cell division.
C) They may result in inactive gene products of the mutated genes.
D) They may result from both frameshift and base-pair substitution mutations.
E) They may be inherited in the offspring of mutated individuals.

F) A) and B)
G) D) and E)

Correct Answer

verifed

verified

A DNA sequence encodes a protein with the amino acid sequence Met-Leu-Ser-Ile-Met-Ala. A mutation occurs in the DNA sequence so that now it encodes a protein with the amino acid sequence Met-Leu-Val. a. Propose an explanation for the type of mutation that produces the new amino acid sequence. b. Give an example of a second mutation that would produce the following amino acid sequence: Met-Leu-Val-Ile-Met-Ala.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

a. The type of mutation that produces th...

View Answer

In the Ames test, what types of mutations are used to test for chemical mutagens?


A) his- to his+ mutations
B) pro- to pro+ mutations
C) pro+ to pro- mutations
D) his+ to his- mutations
E) trp+ to trp- mutations

F) None of the above
G) D) and E)

Correct Answer

verifed

verified

Which of the following is a form of direct DNA repair?


A) base-excision repair
B) nucleotide-excision repair
C) homologous recombination
D) mismatch repair
E) photoreactivation

F) A) and D)
G) B) and D)

Correct Answer

verifed

verified

Showing 21 - 40 of 100

Related Exams

Show Answer