Question 1

Indicate which of the following statements is FALSE.

Accepted Answer

A)   Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure.
B)   Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring.
C)   Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria.
D)   Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.
E)   The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.F) A) and C)
G) B) and E)

Question 2

How did Albert Kossel contribute to our understanding of DNA?

Accepted Answer

A)   used X-ray diffraction to examine the structure of DNA
B)   determined that DNA contains four different nitrogenous bases
C)   found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D)   found that the phosphorus-containing components are the genetic material of phages
E)   discovered "the transforming principle" that could genetically alter bacteriaF) A) and C)
G) C) and D)

Question 3

How many of each of the following does this DNA molecule have?
AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC
a. 3' hydroxyls
b. hydrogen bonds
c. purines
d. ribose sugars

Accepted Answer

To answer the question about the DNA mol...

Question 4

Which circle shows a phosphodiester bond?

Accepted Answer

A)   circle a
B)   circle b
C)   circle c
D)   circle dE) B) and C)
F) C) and D)

Question 5

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA) , yeast nuclei (double-stranded DNA) , rotavirus (double-stranded RNA) , and parvovirus (single-stranded DNA) . The approximate nucleotide base composition of each sample is given in the table below.   Tube  A C U  T G1321703219234161503533021026234331634017\begin{array} { | l | r | r r r | r } \hline 	ext { Tube } & 	ext { A } & \mathbf { C } & 	ext { U } & 	ext { T } & \mathbf { G } \\hline 1 & 32 & 17 & 0 & 32 & 19 \\hline 2 & 34 & 16 & 15 & 0 & 35 \\hline 3 & 30 & 21 & 0 & 26 & 23 \\hline 4 & 33 & 16 & 34 & 0 & 17 \\hline\end{array} Tube 1234​ A 32343033​C17162116​ U 015034​ T 320260​G19352317​​  
-Which tube MOST likely contains mouse cytoplasm?

Accepted Answer

A)   tube 1
B)   tube 2
C)   tube 3
D)   tube 4 E) B) and D)
F) A) and C)

Question 6

How did Rosalind Franklin contribute to our understanding of DNA?

Accepted Answer

A)   used X-ray diffraction to show that the structure of DNA is helical
B)   determined that DNA contains four different nitrogenous bases
C)   found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D)   found that the phosphorus-containing components are the genetic material of phages
E)   used models to show that DNA is a double helixF) A) and E)
G) A) and B)

Question 7

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA) , yeast nuclei (double-stranded DNA) , rotavirus (double-stranded RNA) , and parvovirus (single-stranded DNA) . The approximate nucleotide base composition of each sample is given in the table below.   Tube  A CU T  G 1321703219234161503533021026234331634017\begin{array} { | l | r | r | r | r | r | } \hline 	ext { Tube } & 	ext { A } & \mathbf { C } & \mathbf { U } & 	ext { T } & 	ext { G } \\hline 1 & 32 & 17 & 0 & 32 & 19 \\hline 2 & 34 & 16 & 15 & 0 & 35 \\hline 3 & 30 & 21 & 0 & 26 & 23 \\hline 4 & 33 & 16 & 34 & 0 & 17 \\hline\end{array} Tube 1234​ A 32343033​C17162116​U015034​ T 320260​ G 19352317​​ 
- Which tube MOST likely contains parvovirus?

Accepted Answer

A)   tube 1
B)   tube 2
C)   tube 3
D)   tube 4 E) A) and B)
F) C) and D)

Question 8

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.)

Accepted Answer

A)   The RNA sugar is ribose instead of deoxyribose.
B)   RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA.
C)   The bases in RNA include uracil instead of thymine.
D)   RNA molecules are generally shorter in length than those of DNA macromolecules.
E)   The 2' carbon of ribose has an H, unlike the OH in that position of deoxyribose.F) A) and D)
G) B) and E)

Question 9

Indicate which of the following statements is TRUE.

Accepted Answer

A)   There are three phosphates between each sugar in a molecule of DNA.
B)   A-, B-, and Z-form DNA are all right-handed helixes.
C)   There are three hydrogen bonds between AT pairs.
D)   Ribose sugars have a hydroxyl on the 2'carbon.
E)   All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25% C.F) B) and E)
G) All of the above

Question 10

If the sequence of one strand of DNA is 5'-GCTAGCGTCG-3', what is the sequence of the complementary strand?

Accepted Answer

A)   3'-GCTAGCGTCG-5'
B)   5'-GCTGCGATCG-3'
C)   3'-CGATCGCAGC-5'
D)   5'-CGATCGCAGC-3'
E)   5'-CGAUCGCAGC-3'F) C) and D)
G) B) and E)

Question 11

A DNA molecule of 50 base pairs contains 15 cytosine bases (C) . How many thymine bases will it have?

Accepted Answer

A)   10
B)   15
C)   30
D)   35
E)   60F) A) and B)
G) A) and C)

Question 12

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. 
-You wish to discover which of those three molecules could be the genetic material. You heat-kill some of the purple life form and subject three different homogenized samples to different enzymes: DNase, RNase, or protease. Which sample will NOT transform yellow into purple?

Accepted Answer

A)   DNase
B)   RNase
C)   protease
D)   All will cause transformation.
E)   None will cause transformation.F) A) and B)
G) D) and E)

Question 13

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?

Accepted Answer

A)   45
B)   100
C)   115
D)   135
E)   150F) A) and E)
G) B) and D)

Question 14

Which of these sequences could form a hairpin?

Accepted Answer

A)   5'-GGGGTTTTCCCC-3'
B)   5'-AAAAAAAAAAAA-3'
C)   5'- AAAAGGCCCCCC -3'
D)   5'-TTTTTTCCCCCC-3'
E)   5'-GGGTTTGGGTTT-3'F) All of the above
G) B) and D)

Question 15

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template?
3'-TACCGTGCGTGACATTAAGCC-5'
Write the sequence from 5' to 3', left to right.

Accepted Answer

To determine the sequence of a single-st...

Question 16

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?

Accepted Answer

CpG islands are regions of DNA that have...

Question 17

A molecule that consists of a nitrogenous base bonded to the 1' carbon of a ribose or deoxyribose is a(n) :

Accepted Answer

A)   nucleoside.
B)   hairpin.
C)   isotope.
D)   polynucleotide.
E)   nucleotide.F) All of the above
G) A) and E)

Question 18

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?

Accepted Answer

A)   diagram A
B)   diagram B
C)   diagram C
D)   diagram D
E)   diagram EF) B) and C)
G) D) and E)

Question 19

Which of the following would NOT necessarily be true for a DNA molecule?

Accepted Answer

A)   A = T
B)   C = G
C)   A + G = C + T
D)   A + C = G + T
E)   A + T = G + CF) A) and D)
G) C) and D)

Question 20

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. What might this methylation do to the expression of this gene?

Accepted Answer

A)   nothing
B)   increase
C)   decreaseD) All of the above
E) A) and C)

Exam 10: DNA: the Chemical Nature of the Gene

How many of each of the following does this DNA molecule have? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC a. 3' hydroxyls b. hydrogen bonds c. purines d. ribose sugars

Correct Answer
Answered by ExamLex AI
To answer the question about the DNA mol...
View Answer

A DNA molecule of 50 base pairs contains 15 cytosine bases (C) . How many thymine bases will it have?

Correct Answer
verified

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.)

Correct Answer
verified

Which circle shows a phosphodiester bond?

Correct Answer
verified

How did Rosalind Franklin contribute to our understanding of DNA?

Correct Answer
verified

Which of the following would NOT necessarily be true for a DNA molecule?

Correct Answer
verified

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?

Correct Answer
verified

Indicate which of the following statements is TRUE.

Correct Answer
verified

If the sequence of one strand of DNA is 5'-GCTAGCGTCG-3', what is the sequence of the complementary strand?

Correct Answer
verified

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?

Correct Answer
verified

Indicate which of the following statements is FALSE.

Correct Answer
verified

A molecule that consists of a nitrogenous base bonded to the 1' carbon of a ribose or deoxyribose is a(n) :

Correct Answer
verified

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3'-TACCGTGCGTGACATTAAGCC-5' Write the sequence from 5' to 3', left to right.

Correct Answer
Answered by ExamLex AI
To determine the sequence of a single-st...
View Answer

How did Albert Kossel contribute to our understanding of DNA?

Correct Answer
verified

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?

Correct Answer
Answered by ExamLex AI
CpG islands are regions of DNA that have...
View Answer

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. What might this methylation do to the expression of this gene?

Correct Answer
verified

Correct Answer
verified

Which of these sequences could form a hairpin?

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Exam 10: DNA: the Chemical Nature of the Gene

How many of each of the following does this DNA molecule have? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC a. 3' hydroxyls b. hydrogen bonds c. purines d. ribose sugars

Correct AnswerAnswered by ExamLex AITo answer the question about the DNA mol...View AnswerShow Answer

A DNA molecule of 50 base pairs contains 15 cytosine bases (C) . How many thymine bases will it have?

Correct AnswerverifiedShow Answer

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.)

Correct AnswerverifiedShow Answer

Which circle shows a phosphodiester bond?

Correct AnswerverifiedShow Answer

How did Rosalind Franklin contribute to our understanding of DNA?

Correct AnswerverifiedShow Answer

Which of the following would NOT necessarily be true for a DNA molecule?

Correct AnswerverifiedShow Answer

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?

Correct AnswerverifiedShow Answer

Indicate which of the following statements is TRUE.

Correct AnswerverifiedShow Answer

If the sequence of one strand of DNA is 5'-GCTAGCGTCG-3', what is the sequence of the complementary strand?

Correct AnswerverifiedShow Answer

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?

Correct AnswerverifiedShow Answer

Indicate which of the following statements is FALSE.

Correct AnswerverifiedShow Answer

A molecule that consists of a nitrogenous base bonded to the 1' carbon of a ribose or deoxyribose is a(n) :

Correct AnswerverifiedShow Answer

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3'-TACCGTGCGTGACATTAAGCC-5' Write the sequence from 5' to 3', left to right.

Correct AnswerAnswered by ExamLex AITo determine the sequence of a single-st...View AnswerShow Answer

How did Albert Kossel contribute to our understanding of DNA?

Correct AnswerverifiedShow Answer

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?

Correct AnswerAnswered by ExamLex AICpG islands are regions of DNA that have...View AnswerShow Answer

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. What might this methylation do to the expression of this gene?

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Which of these sequences could form a hairpin?

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Correct Answer
Answered by ExamLex AI
To answer the question about the DNA mol...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
To determine the sequence of a single-st...
View Answer

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
CpG islands are regions of DNA that have...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified